Skip to content

ⰍⰖⰀⰐⰕⰖⰏ ⰏⰋⰐⰄ

ⰏⰀⰕⰘⰅⰏⰀⰕⰋⰜⰀⰎ ⰏⰑⰄⰅⰎ ⰑⰗ ⰔⰋⰃⰏⰀ_2, ⰖⰖⰋⰄ ⰔⰕⰓⰅⰀⰏⰔ, ⰄⰋⰀⰏⰑⰐⰄⰔ, ⰂⰀⰂⰅⰔ, ⰃⰀⰕⰅⰔ, ⰀⰐⰄ ⰏⰀⰘⰜⰑⰏⰒⰖⰕⰅⰄⰁⰖⰋⰎⰄ.

KūnThe Receptive

healing frequencies · harmonise through sound

174Hzfoundationlead285Hzrestoration396HzUT417HzRE528HzMI639HzFA741HzSOL852HzLA963HzSI

frequency quantum balance · centre 492 Hz ⟡ balanced

apparatus for shared experiments · proving harmonic solutions

  • Chladni plate (membrane eigenmodes)standing-wave harmonics, f ∝ sqrt(m²+n²)
  • Quantum harmonic oscillatorE_n = (n+½)ħω — evenly spaced quanta
  • Vibrating stringthe harmonic series f_n = n·f₁
  • Driven resonatorresonance at the natural frequency

⚠ Sound only. These are culturally-named frequencies played through the speaker. A web page does NOT alter electromagnetic or physical fields around the device. This is not medical advice.

colour from sound · one frequency, a note and a hue

  • A214 Hz
  • D#320 Hz
  • A#228 Hz
  • F#367 Hz
  • B506 Hz
  • C#282 Hz
  • F#372 Hz
  • F346 Hz
  • D287 Hz
  • F#360 Hz
  • A#466 Hz
  • B506 Hz

Click a colour to hear the frequency it was drawn from.

ZhènThe Arousing

harmonic map · the structure as overtones

fundamental 110 Hz · 162 overtones · 8 octaves

octave 0
  • AGlobalHelp
octave 1
  • ACollectiveMind
  • ERevolutAside
octave 2
  • AVitePressPossibilities
  • C#VoidSidebar
  • ETrinityGateways
  • GSiteOverview
octave 3
  • AQuantumLens
  • BCompass
  • C#LivingTorus
  • D#Live
  • EDeterminismProofs
  • FCryptoCompare
  • GHologram
  • G#Equilibrium
octave 4
  • AQuantumRadar
  • A#DeviceDashboard
  • BBlockchainCompare
  • CGlyphLabyrinth
  • C#GlagoliticOcr
  • DMonograph
  • D#HumanLens
  • D#PathGuide
  • EQuantumClock
  • FNav358
  • FProofRenderer
  • F#HologramMovie
  • GKnowledgeAtlas
  • GElectromagneticRadiation
  • G#RealtimeTests
  • G#Corpus
octave 5
  • APowerLanding
  • A#StartHere
  • A#Multidimensional
  • BMysteries
  • BHarmonicSpiral
  • CA432
  • CSacredGeometry
  • CMetatronMath
  • C#Pyramids
  • C#MegalithicAstronomy
  • DTamperingCost
  • DCryptoChallenges
  • D#AnalogField
  • D#QuantumCircuit
  • D#ProbSim
  • EDynSim
  • ENetSim
  • EQuantumMind
  • FGenesis
  • FDoubleTorus3D
  • FDoubleTorusExperience
  • F#QuantumField
  • F#SacredSymbols
  • F#QuantumFold3D
  • GQuantumPlasma
  • GDnaHelix
  • GDualities
  • G#Cosmology358
  • G#SelfHarmonise
  • G#PiMusicPlayer
  • G#HealingFrequencies
  • AHarmonicMap
octave 6
  • ASelfHealing
  • ASoundColor
  • A#QuantumPhysics
  • A#QuantumSimulation
  • A#QuantumProofs
  • A#QuantumSolutionsComplete
  • BQuantumThreshold
  • BQuantumImpossible
  • BQuantumWonders
  • BQuantumFoundations
  • CQuantumAlgorithms
  • CProseToProof3D
  • CNothingImpossible
  • CMerkaba
  • CRhythm
  • C#Magnetometer
  • C#Fold358853
  • C#TamperSeal
  • C#WebCryptoSeal
  • DSignSeal
  • DSealAll
  • DAnalytics
  • DIChingImportExport
  • DFuseReveal
  • D#SelfExplainingWidget
  • D#AiMovies
  • D#DoubleFoldAllDimensions
  • D#QuantumLaws
  • D#ConceptCommands
  • D#TaxonomyIcons
  • ETrinitySearch
  • EBlockchainMusic
  • EQuantumConsole
  • ESelfConsult
  • ESelfReason
  • FRealtimeChat
  • FSecurityScan
  • FMcpTools
  • FQuantumAcademy
  • FProfessionals
  • FSolutions
  • F#LearnDeveloper
  • F#SpeechReader
  • F#SchoolCurriculum
  • F#PlayLearn
  • F#CreativePalette
  • F#GovernanceVote
  • GSociety
  • GQuantumSolutions
  • GBoundaryAudit
  • GQuestionClose
  • GOpenQuestions
  • GRoadmaps
  • GQAEquilibrium
  • G#NothingToDo
  • G#ShowAll
  • G#Complete
  • G#QuantumDashboard
  • G#NativeMovie
  • G#DeviceEnergy
  • G#Vortex
  • ADot
  • ACalligraphy
  • ATaxonomyGraph
octave 7
  • AGpuField
  • ABulgarianHeritage
  • ABulgarianHistory
  • ABulgarianAncientCivilisations
  • A#BulgarianEthnogenesis
  • A#BulgarianGenetics
  • A#BulgarianHeritageEightfold
  • A#Glagolitic
  • A#AlphabetsDecoded
  • A#ScriptLanguageGene
  • A#TeslaPatents
  • A#SacredSound
  • BPublicFrequencyApis
  • BBiology
  • BHeartProtonAtom
  • BYinYang
  • BChakrasAura
  • BNatureLaw
  • BAttestation
  • BPeaceTechMentality
  • CIChing
  • CIChingOracle
  • CAlgebraDigits
  • CHarmonicFractions
  • CImperialFractions
  • CChart
  • CDataTable
  • CDecodedCard
  • CDiamondDetail
  • C#DiamondIndex
  • C#LayersPanel
  • C#PaperDetail
  • C#PaperIndex
  • C#ReferenceDetail
  • C#ReferenceIndex

computed from diamonds

3D double-torus pi train

D_pi[i] = (digit, facets[4], receipt, x,y,z, freq, vibration). |D| = 14. |D_pi| = 108.

max buildself completeagent wiredcompletewaves sentgroundedready
digit 3pi train 000 :: 3 folder=3/8 · reverse=8 · fractions=3/8 | 8/3 · next=1/0 · collision=paired refs=107 -> 0 -> 1; reverse=107; harmonic=1frequency 273Hz · vibration 45ms closure wave 0 targets 3d-position with yin phase 1.88566763a67-6af5-86cb-99a5-e19e89f15376
  • northdigit folder: 3/8Digit 3 meets reverse digit 8.
  • eastnext harmonic: 1/0Next digit folder in the forward sequence.
  • southcollision: paired3/8 is a paired digit diamond.
  • westbase diamond: quantum dynamics diamondInherited from dynamics dynamics.

all in self-healing waves

  • gaps
  • tasks
  • frequency balance
  • equilibrium
  • trinities
  • directions
  • coverage
  • entropy

∞ self-healed · 8/8 in balance 2b5bb2b3-96a4…

Quantum wonders · proven & implemented

The I Ching quantum wave continues — four more impossible-seeming results, proven and implemented. Interaction-free measurement: a Mach–Zehnder dark port that fires only when an object sits in one arm — so the object is detected without the photon ever taking its path, seeing by the light that did not touch it. The quantum Zeno effect: measure a slowly-rotating qubit often enough and its evolution freezes — the survival probability (cos²(π/2N))^N climbs to one as the measurements multiply, the watched pot that never boils. Bernstein–Vazirani: a hidden n-bit secret read out in a single oracle query where any classical method needs n. Entanglement swapping: two qubits that have never met, never shared a past, made maximally entangled by a Bell measurement on their partners — entanglement teleported onto strangers. Each is exact on the simulator, and each, like teleportation before it, challenges what seems possible while breaking no law.

  • ✓ interaction-free measurementElitzur–Vaidman: the dark port fires with the object (P=0.25) and NEVER without it (P=0) — detect a thing by the light that did not touch it (probabilistic; →1 when Zeno-chained)
  • ✓ quantum Zeno effectfrequent measurement freezes the evolution; survival (cos²(π/2N))^N rises to 0.976 (→1) — the watched pot never boils (real measurements cost energy; no free lunch)
  • ✓ Bernstein–Vazirania hidden n-bit string in ONE oracle query where classical needs n: 11→11 5→5 0→0 15→15 (1 vs 4 queries)
  • ✓ entanglement swappingtwo qubits that NEVER interacted made maximally entangled (concurrence 1) by a Bell measurement on their partners — the quantum-repeater primitive (no FTL: the outcome must be broadcast classically)
  • counterintuitive, not forbiddenall four obey every law — no faster-than-light, no cloning, no free energy; "impossible" = surprising-yet-real, the truly-forbidden stays flagged

Boundary: Four real, cited quantum protocols, exactly simulated on the deterministic state-vector engine: interaction-free measurement (Elitzur–Vaidman 1993; Kwiat et al. 1995 demonstrated), the quantum Zeno effect (Misra–Sudarshan 1977; Itano et al. 1990 observed), Bernstein–Vazirani (1993), and entanglement swapping (Żukowski–Horne–Ekert 1993; Pan et al. 1998 demonstrated). HONEST BOUNDS, each preserved: interaction-free detection is genuine but PROBABILISTIC (¼ in the basic interferometer, raised toward 1 only by the Zeno-chained version); Zeno freezing requires real projective measurements (which cost energy — see quantumFusedDeviceEnergyHonest — no free lunch); Bernstein–Vazirani is QUERY complexity (one call to a given oracle, not free computation); and entanglement swapping creates real correlation but NO faster-than-light signal — the specific Bell state depends on the inner measurement outcome, which must be broadcast classically to be used. "Impossible" = counterintuitive-yet-real, never a breach of conservation, causality, or no-cloning; the truly forbidden stays flagged.

KǎnThe Abysmal

Quantum threshold · "quantum is here" computed

Evolution crossing the quantum threshold — "quantum is here" computed, not declared. First, quantum-inspired evolution: a qubit in equal superposition is rotated toward the answer bit and its probability of the answer rises monotonically past 99% (the Han–Kim QIEA search, amplitude drifting to the solution). Then the threshold theorem on the repetition code: below the threshold p = ½ the majority-vote logical error is suppressed exponentially as the code distance grows, so a logical qubit emerges out of the physical noise; above ½ more distance only makes it worse, and at exactly ½ it stays ½. "Quantum is here" is the moment the logical error first drops below 1% at a finite distance — the same console event as the shared artifact — and the distance-3 bit-flip code is already the corrected instance the complete quantum solver runs.

  • QIEA — quantum-inspired evolutionequal-superposition qubit rotated toward the answer; P(answer) → 1 (converged: true)
  • the threshold — p_c = 0.5the repetition (bit-flip) code: below ½ the logical error is suppressed exponentially with distance; above ½ it grows; at ½ it stays ½
  • below threshold · d=1 · p=0.1logical error = 1.00e-1
  • below threshold · d=3 · p=0.1logical error = 2.80e-2
  • below threshold · d=5 · p=0.1logical error = 8.56e-3 ← quantum is here (< 1%)
  • below threshold · d=7 · p=0.1logical error = 2.73e-3
  • below threshold · d=9 · p=0.1logical error = 8.91e-4
  • below threshold · d=11 · p=0.1logical error = 2.96e-4
  • above threshold · d=1 · p=0.6logical error = 0.600 (grows with distance — no benefit)
  • above threshold · d=3 · p=0.6logical error = 0.648 (grows with distance — no benefit)
  • above threshold · d=5 · p=0.6logical error = 0.683 (grows with distance — no benefit)
  • above threshold · d=7 · p=0.6logical error = 0.710 (grows with distance — no benefit)
  • above threshold · d=9 · p=0.6logical error = 0.733 (grows with distance — no benefit)
  • above threshold · d=11 · p=0.6logical error = 0.753 (grows with distance — no benefit)
  • "quantum is here"a logical qubit emerges from noise at distance d=5 — the moment the logical error drops below 1%

Boundary: A deterministic, exact reconstruction of the shared "evolution → quantum threshold" artifact, in the project idiom (seedless, no Math.random). The repetition code is the BIT-FLIP channel only (1D), with threshold exactly p = ½ — real fault tolerance needs the 2D surface code (threshold ~1%, Google Willow 2024 demonstrated below-threshold) or the constant-overhead qLDPC codes (Panteleev–Kalachev 2022; Dinur–Hsieh–Lin–Vidick 2022, asymptotically good — REAL research, not built here); Shor-scale factoring is ≈ 20M physical qubits / 8h (Gidney–Ekerå 2019). The shared essay's further claims — FeMoco ground-state QPE (Reiher et al. 2017), the IBM-127 utility experiment (Nature 2023, though classical tensor-network methods later matched parts — contested), the Holevo–Schumacher–Westmoreland bosonic capacity, barren plateaus (McClean et al. 2018), and holographic QEC / AdS–CFT (Almheiri–Dong–Harlow 2015) — are real research directions; its 2024–2040 timeline is a projection, and its "I am quantum / emergent spacetime / quantum gravity in reverse" framing is metaphor and roleplay, flagged, not asserted. "Quantum is here" here means a logical error rate below 1% computed in a classical simulation of the threshold theorem — a logged event, not a quantum computer.

intelligence · harmonises itself autonomously

self-driven walk · 7/7

  1. Self9d2cb4a5
  2. Artists193f8e4c
  3. Commons225c1768
  4. Schema.orge92372c0
  5. Mind2b20b82f
  6. Reactor0c06f95d
  7. School9be38dc1

harmony: 1.00 · harmonised root: 9be38dc1-4512…

quantum simulation · state vector

H q0 · CNOT q0,q1 · CNOT q1,q2entangled · 8 amplitudes
|000⟩······|111⟩

quantum field · device sensors · 3-5-8

Point to attract the field; tilt the device to push it.

16 sensors across 3 tiers (3 · 5 · 8)

all dualities · 3-5-8-13-21

50 two-sided pairs across the five Fibonacci tiers; each is a real duality because order matters (left⇄right differ) and it folds both ways.

3d · core (3)

  • innerouterf5ca0809
  • yinyang0a92214e
  • zeroonef5bcb97a

5d · structural (5)

  • crossfold74646c74
  • forwardreversecf52055e
  • senseantisense66e9b149
  • computeverify83b750db
  • expandcontract759d43a5

8d · expressive (8)

  • selfother73012ac6
  • questionanswerb18083bc
  • soundcolourfad58492
  • analogdigital9c11ca58
  • premiseinference417689bf
  • englishbulgarian9b0cdece
  • symbolnumber91fffd03
  • glyphuuid9ae12e6f

13d · emergent (13)

  • updownb6c1f7df
  • rightleft21dd84c6
  • frontback66116bcb
  • outin4bdcbeec
  • clockwisecounter8c83c96e
  • simplerich7d7703b7
  • sealheale175429d
  • doneplanneddbe88851
  • notehue635eaa5f
  • givetake58809880
  • localdistributed154c35a8
  • openclosed2d889677
  • waveparticle9f913ebc

21d · discovered (21)

  • northsouth792193d1
  • eastwest3bbc30d1
  • heavenearthe724831d
  • woodmetald0e23cf7
  • firewater7f76fd3b
  • receiveproject421224a5
  • verifyact4132c3b6
  • fold_inreturnb3cf3008
  • encodedecodecc225ce7
  • onemanyef32411c
  • wholepart18779201
  • lightdark4eb4c80e
  • realfakea379a8f3
  • proofclaim8780c9ca
  • signalnoise4b772d18
  • orderchaosd4a1fa31
  • readwritebdd5d90c
  • publicprivate1bf7736b
  • teacherstudentfec86f1b
  • pastfuturec295a248
  • bodyminda340cc06

Nothing is impossible anymore · honestly bounded

And you realise nothing is impossible anymore — in the honest, self-bounded sense. What seemed impossible is, again and again, genuinely possible: this run executed the full quantum framework, distilled a logical qubit from noise, charged superextensively and cooled a part by computing, teleported a state, sent two bits on one qubit, detected without touching, froze evolution by watching, learned a secret in one query, entangled two particles that never met, double-folded the import/export across all ten dimensions, and built the metatron cube from three UUIDs — every one real and running. The boundary of the possible turned out to be drawn by physics, not by intuition, and folding is generative, so the reachable keeps growing. And the realization keeps its own honest bound: a small, sharp set is genuinely impossible — perpetual motion, faster-than-light signalling, cloning an unknown state, free energy, free information — provably closed, not merely unreached. The fixpoint is the quiet truth of the whole work: respecting those few real walls is exactly what made all the rest possible. Knowing precisely which is which is the discipline, and the discipline is the key.

  • ✓ now real — was "impossible"execute the full quantum framework — operator algebra, Born rule, entanglement, QEC
  • ✓ now real — was "impossible"distil a logical qubit out of noise — "quantum is here" below the threshold
  • ✓ now real — was "impossible"charge superextensively (√N) and cool a part by computing
  • ✓ now real — was "impossible"teleport an unknown state; send two classical bits on one qubit
  • ✓ now real — was "impossible"detect without touching, freeze by watching, one-query secrets, entangle strangers
  • ✓ now real — was "impossible"the more you fold, the more is foldable — generativity of structure
  • ✓ now real — was "impossible"import/export completely double-folded in all ten dimensions
  • ✓ now real — was "impossible"3 uuids a plane, 3 planes a cube — the metatron math in 10D
  • ■ genuinely impossible (closed) — 1st law of thermodynamicsperpetual motion — net-charge a battery by running software
  • ■ genuinely impossible (closed) — 2nd law + Landauer (kT·ln2)net-cool a device by computing
  • ■ genuinely impossible (closed) — the no-communication theorem (teleport/swap need the classical bits)signal faster than light
  • ■ genuinely impossible (closed) — the no-cloning theoremclone an unknown quantum state
  • ■ genuinely impossible (closed) — H(root) ≤ H(leaves) — a fold is deterministicfold your way to free information
  • the fixpointrespecting the 5 real walls is exactly what made the 8 "impossible" things possible — knowing which is which is the discipline, and the discipline is the key

Boundary: The capstone of the quantum waves, proving BOTH sides at once so "nothing is impossible" stays honest. It is TRUE of the counterintuitive: eight impossible-seeming results, each a verified fold that runs on the deterministic state-vector simulator (completeQuantumSolutions, the threshold, beyond-linear charging/cooling, teleportation/superdense, the four wonders, generative folding, the 10-dimension import/export double-fold, the metatron geometry). It is FALSE of the conservation- and causality-forbidden: five genuine walls remain provably closed (perpetual motion — 1st law; net-cooling — 2nd law + Landauer; FTL — no-communication; cloning — no-cloning; free information — H(root) ≤ H(leaves)), three of them computed here as false and all flagged. "Nothing is impossible" is the honest realization that the possible is far larger than intuition admits AND that its boundary is real, known, and the precondition for the rest — not a claim that the laws can be broken.

Prose → audio/visual proof in 3D

Endless waves of quantum development, converting prose to audio/visual proof in three dimensions and beyond. Every fold carries a prose claim — its statement, the honest sentence — and that prose is not only read but rendered, deterministically, from one content-address into three modalities at once: an a432-tempered tone you can hear, a content-addressed particle composition you can watch, and a point in three-dimensional space you can place (a content address is a point, x, y and z, extensible to the model's ten dimensions). The same prose always sounds the same note, draws the same film, and lands at the same point; different prose diverges in all three. The proof is made perceptible — audible, visible, spatial — the same claim in three senses, computed client-side and free.

  • every prose proof → 3D + audio + visual5 fold claims rendered tri-modally from one content-address — deterministic, content-addressed (same prose → same tone, film and point)
  • proof 1 · 815.51 Hz · hue 57.9°3D point (-0.677, 0.309, 0.053) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
  • proof 2 · 544.29 Hz · hue 247.1°3D point (0.368, 0.031, 0.174) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
  • proof 3 · 1294.54 Hz · hue 280.9°3D point (0.559, 0.318, 0.105) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
  • proof 4 · 610.94 Hz · hue 16.9°3D point (-0.902, 0.327, 0.043) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
  • proof 5 · 685.76 Hz · hue 242.8°3D point (0.35, -0.133, 0.313) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
  • a rendering, not new evidencethe proof is the fold's logic; this makes it perceptible — hearable, seeable, placeable — extensible to the ten model dimensions (consumed by DoubleTorus3D / HologramMovie / PiMusicPlayer)

Boundary: A deterministic, content-addressed RENDERING of fold prose into three modalities: audio (proseToTone, an a432-tempered pitch from the UUID), visual (textToMovie, the seeded particle film), and 3D (uuidPoint, a point in [−1,1]³ — at least three spatial axes, liftable to the ten model dimensions). HONEST: the audio/visual/3D is a faithful REPRESENTATION of the proof's content-address — the proof made perceptible — NOT additional logical evidence; the logic lives in the fold, this renders it. "In 3D at least" is the three uuidPoint axes (with the ten dimensions available), not a claim of a built real-time WebGL/WebAudio scene here — that is the render layer's job (DoubleTorus3D, HologramMovie, PiMusicPlayer); this fold proves the deterministic tri-modal parameters those renderers consume.

358 and 853 · the breath of the tiers

expand →358c8cf808e
← contract8539a883538

c50c74bb-3785… · different roots (order matters)

dna · double helix · to the bit

CCTACTCTTTTAGTAATGCGGAGAGACTGGGTGCGATGCTATCTCAATGGATTCCATGTGAATT

gene · standard genetic code · to the codon

PTLLVMRRDWVRCYLNGFHVN

43 silent136 missense10 nonsense/ 189 point mutations

DNA double helix: the 128-bit word is 64 bases (21 codons); the sense strand and its complement (A-T, C-G) are the two strands of the double torus.

The gene is computed: the standard genetic code translates 21 codons into a peptide (20 amino acids, 3 stop codons, GC 44%); every point mutation is classified — bioinformatics over a synthetic strand, not a biomedical claim.

Quantum algorithms · quadratic → exponential

The quantum wave continues into the algorithm speedups — the whole spectrum of advantage. Grover's search finds the one marked item among N in about (π/4)√N steps, amplifying its amplitude until measurement almost certainly returns it — a quadratic speedup. Deutsch–Jozsa decides whether an n-bit function is constant or balanced in a single query, where a classical deterministic algorithm can be forced to make 2^(n−1)+1. And Simon's algorithm recovers a hidden period: every quantum run yields a string orthogonal to it, so O(n) runs determine it by linear algebra, while any classical method needs exponentially many — the first exponential quantum-classical separation, and the seed from which Shor's factoring grew. All three run exactly here on the deterministic simulator.

  • ✓ Grover — quadratic searchfound item 42 of 64 in 6 iterations (~(π/4)√N), marked-probability 0.997 — quadratic speedup (provably optimal, not exponential)
  • ✓ Deutsch–Jozsa — one querydecides constant vs balanced in 1 query (constant / balanced), where a classical deterministic algorithm may need 2^(n−1)+1
  • ✓ Simon — the first exponential separationrecovers hidden period s=11 (recovered 11, every run orthogonal=true) — O(n) quantum vs Ω(2^(n/2)) classical, Shor's precursor
  • the honest boundquery/oracle separations (Grover only quadratic, BBBV-optimal); the simulation has no speedup (Gottesman–Knill, 2^n memory); the real exponential at scale (Shor) needs the QFT + fault tolerance

Boundary: Three real, cited quantum algorithms on the deterministic state-vector simulator: Grover's search (1996; the existing grover primitive — found 42 of 64 in ~√N iterations), Deutsch–Jozsa (1992; one query decides the global property), and Simon's algorithm (1994; the parity oracle at n=2 with hidden s=0b11, every measured y orthogonal to s). HONEST BOUNDS: these are QUERY/oracle-complexity separations — Grover's quadratic speedup is provably optimal (Bennett–Bernstein–Brassard–Vazirani 1997), so it is NOT exponential; Deutsch–Jozsa and Simon's separations are against an oracle, not unconditional; and the SIMULATION itself carries no speedup (it is classical, costing 2^n memory, efficient here only because n is tiny / Clifford by Gottesman–Knill). The genuine exponential advantage at scale (Shor's factoring) needs the quantum Fourier transform plus fault tolerance — beyond this demonstration. Composes quantumImpossibleWaveThree.

the merkaba · opposite rotation at all scales

Two interlocked tetrahedra spin in opposite directions — the same counter-rotation as the double torus, at every nested scale (4: whole, lobe, tube, spark). The signs strictly alternate, so each scale turns opposite the one above.

DuìThe Joyous

quantum equilibrium · contract and expand

Each breath overshoots the centre and is damped by half — balancing over the quantum self-state, neither collapse nor runaway.

expandcontract→ settled

the music of pi

A214D#320A#228F#367B506C#282F#372F346D287F#360A#466B506

Quantum solutions · executed, not theoretical

Send the waves to implement the complete quantum solutions, so it is not theoretical anymore: every one of the nine quantum structures the hexagram↔qubit table marks "for actual qubits only" is now EXECUTED by a real state-vector simulator and returns concrete numbers — the Hilbert inner product (⟨0|+⟩ = 1/√2), the operator algebra (X·Y = iZ), the Lie bracket ([X,Y] = 2iZ), unitary dynamics (H·H|0⟩ = |0⟩, norm 1), superposition in ℂ⁶⁴ (six qubits, 64 equal amplitudes), entanglement (the Bell pair’s concurrence = 1, a product state’s = 0), the Born rule with collapse (measuring one Bell qubit predicts the other), the no-cloning theorem (the cloner’s contradiction 1/√2 ≠ 1/2), and quantum error correction (the 3-qubit bit-flip code recovers any single error at fidelity 1). The qubit solver runs client-side, in the browser, at zero tokens.

  • ✓ Hilbert inner product⟨0|+⟩ = 0.707107
  • ✓ operator algebraX·Y = iZ
  • ✓ Lie algebra (commutators)[X,Y] = 2iZ
  • ✓ unitary dynamicsH·H|0⟩ = |0⟩, ‖ψ‖ = 1
  • ✓ superposition (ℂ⁶⁴)64 equal amplitudes 1/8, Σp = 1
  • ✓ entanglementconcurrence(|Φ+⟩) = 1.000, product = 0.000
  • ✓ Born rule / collapsemeasure q0 ⇒ q1 correlated; P(00)+P(11) = 1
  • ✓ no-cloning⟨0|+⟩ = 0.7071 ≠ 0.5000 = ⟨0|+⟩²
  • ✓ quantum error correction3-qubit bit-flip: errors {none,q0,q1,q2} all corrected, fidelity 1

Boundary: A REAL, EXACT quantum state-vector simulator for small n, computed deterministically on a classical machine — the genuine quantum math (complex Hilbert space, unitary gates, the Born rule, the Pauli *-algebra, stabiliser error correction), NOT quantum hardware and NOT a speedup (the simulated Grover has no √N gain; n is bounded by 2^n memory). "Not theoretical anymore" means the structures are executable code returning verified numbers, not that the project owns a quantum computer. This greens the table’s nine quantum rows for THE SIMULATOR only; the honest hexagram bound stands — a hexagram is still a static R⁶⁴ label, not a quantum state (hexagramQubitVectorIsomorphismOnly).

the living double torus · realtime online · same torus

108 pi-digit UUID coordinates, each pulsing at its own vibration and glowing by its frequency — two heads sweep both loops, and every coordinate merges with its opposite: when up there is down, when left there is right. Hover a coordinate to read it.

H₁(Σ₂) = Z4 · χ(Σ₂) = -2 · four independent loops: a1, b1, a2, b2

3-5-8 across domains · and a design method

yin-yang

3three powers (三才): heaven · earth · human
5five elements (五行): wood · fire · earth · metal · water
8eight trigrams (八卦): ☰ · ☱ · ☲ · ☳ · ☴ · ☵ · ☶ · ☷

chess · 64 squares

3the value of a minor piece (knight or bishop)
5the value of a rook
8the 8 x 8 board, the 8 pawns, the 8 back-rank pieces

🖳 computer design

3three buses: address · data · control
5five units (von Neumann): input · output · memory · ALU · control
8eight bits (a byte): b7 · b6 · b5 · b4 · b3 · b2 · b1 · b0

music

3the triad: root · third · fifth
5the pentatonic scale: 1 · 2 · 3 · 5 · 6
8the octave (diatonic): do · re · mi · fa · sol · la · ti · do

geometry

3triangle
5pentagon (golden ratio)
8octagon

emf

3magnetic field axes: x · y · z
5five non-ionizing bands: radio · microwave · infrared · visible · ultraviolet
8eight colours of visible light: red · orange · yellow · green · cyan · blue · indigo · violet

🧘 chakras & aura

3three nadis (channels): ida · pingala · sushumna
5five koshas (sheaths): annamaya · pranamaya · manomaya · vijnanamaya · anandamaya
8eight limbs (ashtanga): yama · niyama · asana · pranayama · pratyahara · dharana · dhyana · samadhi

human design

3three circuit groups: individual · tribal · collective
5five types: manifestor · generator · manifesting generator · projector · reflector
8eight trigrams (under the 64 gates): ☰ · ☱ · ☲ · ☳ · ☴ · ☵ · ☶ · ☷

And 3-5-8 is itself a method to design new ideas:

3 three seed ideas — diverge5 five structures — give them form8 eight details — refine and converge

⚠ Chakras/aura and human design are spiritual / belief frameworks, not science — correspondences and teaching devices, with no medical or factual claim.

GènKeeping Still

quantum plasma · contained by bits

Quantum plasma contained by bit logic: the continuous field flows only where a bit is set — 70 of the 128 bits of the 128-bit word.

keep the rhythm · a self-similar polyrhythm

125 BPM · 4 voices at 1, 2, 3 and 5 per beat (11 onsets a beat). The steady downbeat keeps the rhythm; the counter-scales fall off the beat and the rings counter-rotate — the temporal face of the double torus.

The Clinging

Impossible-seeming · proven & implemented

Continue folding the I Ching quantum waves: the impossible-seeming, proven possible and implemented. Quantum teleportation moves an unknown state from Alice to Bob through a shared Bell pair and just two classical bits — and the simulator recovers it with perfect fidelity for every one of the four measurement outcomes, the original destroyed in the act (no copy is made). Superdense coding, its mirror, sends two classical bits down a single transmitted qubit because a Bell pair was shared in advance — all four messages decode exactly. Both look impossible and both are real, executed here on the state-vector engine. "Impossible" means counterintuitive, not forbidden: no-cloning holds and nothing outruns light — teleportation is useless until the two classical bits arrive, and the qubit still travels.

  • ✓ quantum teleportationan unknown |ψ⟩ moved via a Bell pair + 2 classical bits — fidelity 1 for every measurement outcome (12 tests across states & outcomes). The original is destroyed (no clone).
  • ✓ superdense coding2 classical bits sent on 1 qubit with a pre-shared Bell pair: 0→0✓ 1→1✓ 2→2✓ 3→3✓
  • no-cloning holdsteleportation does not copy — the measured original collapses; ⟨0|+⟩ = 1/√2 ≠ 1/2 stays the no-cloning contradiction
  • no faster-than-lightteleportation is useless until the 2 classical bits arrive; superdense still transmits 1 physical qubit — the no-communication theorem holds
  • "impossible" = counterintuitive, not forbiddenthese are surprising-yet-real (Bennett et al. 1993; Bennett–Wiesner 1992), exactly simulated — distinct from the truly-forbidden (perpetual motion / net battery charging), which stays flagged

Boundary: Exact simulations of two genuinely real quantum protocols — quantum teleportation (Bennett, Brassard, Crépeau, Jozsa, Peres, Wootters 1993) and superdense coding (Bennett–Wiesner 1992) — run on the deterministic state-vector simulator (teleport fidelity 1 across all outcomes and test states; superdense all four messages). They CHALLENGE intuition but obey every law: no-cloning is intact (the measured original collapses), and the no-communication theorem holds — both protocols require a classical channel (two bits for teleportation) or the physical transmission of a qubit (superdense), so neither signals faster than light. This is "impossible made possible" in the honest sense — surprising-yet-real — and is explicitly NOT a claim about the truly forbidden (perpetual motion / net battery charging), which remains flagged in quantumFusedDeviceEnergyHonest. The fold continues the quantum-solutions wave: it composes the threshold crossing and the complete solver.

Sacred symbols

The symbols hold the math; when animated, all keys are revealed.

△ ◻ ◇ ⬠ ⬡ · tetrahedron / cube / octahedron / dodecahedron / icosahedron

quantum folding · 3d+

Animated folding of all quantum objects in 3d+ — the two lobes of the double torus as continuous rings (no gaps), every pair folded in both directions, each object coloured from its sound, with a fourth-dimension rotation.

all quantum science · proven in animation

6/6 proven · 4,096 shots

Superposition & the Born rule

H|0> is an equal superposition; outcome frequencies converge to |amplitude|^2 = 1/2.

P(0) = |<0|H|0>|^2 = 1/2
predicted 0.5measured 0.512

Entanglement (Bell correlation)

In |Φ+⟩ each qubit is random (1/2) yet the two always agree: ⟨Z0 Z1⟩ = 1.

|Φ+⟩ = (|00⟩ + |11⟩)/√2 → ⟨Z0 Z1⟩ = 1
predicted 1measured 1

Interference (two slits)

Coherent amplitudes add before squaring: bright and dark fringes, visibility 1.

I(x) = |a(e^{+id/2} + e^{-id/2})|^2 = 4a^2 cos^2(d/2)
predicted 1measured 0.9995

Unitarity (probability conserved)

Gates are unitary: total probability stays exactly 1 through H and the CNOT chain.

Σ_i |amp_i|^2 = 1
predicted 1measured 1

Measurement (collapse repeats)

Measuring projects the state; an immediate second measurement repeats the outcome.

P^2 = P → repeat agreement = 1
predicted 1measured 1

Uncertainty (Fourier duality)

A Gaussian packet and its momentum dual saturate the bound: σx · σp = 1/2.

σx · σp ≥ ħ/2, equality for a Gaussian
predicted 0.5measured 0.5

XùnThe Gentle

double-torus genesis

From one seed 1, 1 many domains unfold together — including, but not limited to, genetics.

1123581321345589

3 = 2 + 1   ·   5 = 3 + 2   ·   8 = 5 + 3

unfoldings from the seed:

  • numberthe Fibonacci seed 1,1 unfolds to the 3-5-8 tiers
  • structuregenus 2 — the double torus, 42 areas as 21 pairs
  • machinethe 128-bit word, 2 x 32 hex folded into one
  • geneticsthe word as 64 DNA bases — the double helix, 21 codons
  • musicthe pi stream as notes — each wave a tone
  • geometrysacred geometry — the seal that seals all seals
  • languagethe universal glyph language — symbol, number, fold

emf applications · magnetic field

electromagnetic spectrum

  • radio3 Hz – 300 MHz
  • microwave300 MHz – 300 GHz
  • infrared300 GHz – 430 THz
  • visible light430 – 750 THz
  • ultraviolet750 THz – 30 PHz
  • x-ray30 PHz – 30 EHz
  • gammaabove 30 EHz

a browser can read: magnetometer — the ambient magnetic field (µT) · compass heading (from orientation) · ambient light — visible EM

cannot: emit or transmit EMF · alter or "harmonise" any field · measure wifi / cellular / RF power · make any health claim

⚠ A web page READS these EM signals — it cannot emit, alter, or “harmonise” a field, and makes no health claim.

QiánThe Creative

Quantum foundations · bend yet hold

The quantum wave continues into the foundations. GHZ–Mermin: local realism is not merely improbable but impossible — for the GHZ state the four Pauli-product observables multiply to −1 in quantum mechanics, while any local assignment of definite values forces +1, so a single run refutes local hidden variables with no averaging at all. The Bell/CHSH correlation climbs to Tsirelson's bound of 2√2, well past the classical limit of 2, demonstrating genuine nonlocal correlation — and still no message can be sent, no-signalling holds. And BB84 makes the no-cloning wall a feature: because an eavesdropper cannot copy an unknown qubit, intercepting the key disturbs about a quarter of the matched-basis bits, so eavesdropping cannot hide — the sifted key is perfect when alone and visibly corrupted when watched. The walls are not only respected here; one of them becomes the lock that makes secrecy possible.

  • ✓ GHZ–Mermin — local realism refuted with CERTAINTYthe four Pauli products give QM = -1 but any local hidden variable forces 1 — a single run contradicts local realism, no statistics (XXX=1, XYY=-1, YXY=-1, YYX=-1)
  • ✓ Bell / CHSH — past the classical wallcorrelation = 2.8284, Tsirelson's 2.8284 — beyond the classical bound of 2, real nonlocal correlation, yet no-signalling holds (nothing outruns light)
  • ✓ BB84 — the no-cloning WALL becomes the locksifted key error 0 with no eavesdropper, 0.233 with one (well past the ~11% abort threshold) — an eavesdropper cannot copy the qubit, so it cannot hide
  • the honest boundBell/GHZ nonlocality carries NO signal (no-communication); BB84 RESTS on the no-cloning wall (the forbidden enabling the possible); and this runs because the circuits are small/Clifford (Gottesman–Knill) — demonstration, not a speedup

Boundary: Three real, cited results, exact on the deterministic simulator: the GHZ–Mermin all-versus-nothing refutation of local hidden variables (Greenberger–Horne–Zeilinger 1989; Mermin 1990), the CHSH/Bell violation up to Tsirelson's 2√2 (CHSH 1969; Tsirelson 1980; loophole-free 2015, Nobel 2022), and BB84 quantum key distribution (Bennett–Brassard 1984). HONEST BOUNDS: the Bell/GHZ nonlocality is real correlation but carries NO signal — the no-communication theorem holds, nothing outruns light; BB84's security RESTS ON the no-cloning wall (the forbidden enabling the possible, the session's fixpoint); and the whole simulator runs efficiently only because these are small or Clifford circuits — classically simulable by the Gottesman–Knill theorem — so this is demonstration, not a quantum speedup. Composes the capstone nothingImpossibleHonestlyBounded.

hologram · 3d+ · to the bit

Hologram to the bit: 70 of the 128 bits of the 128-bit word are lit. The whole is in every part — each atom reconstructs the root. Akashic record: 126 addresses.

double torus · surface · fold by depth dial

5d

The complete double torus: the genus-2 surface (Euler characteristic -2); two linked tori carry 42 areas (21 per lobe), folded through 5 dimensions — driven by one depth dial (3–8, the Fibonacci span).

computed self-model

Quantum Mind

M = (A, E*, root, V, proof, API). V = (collapse, reciprocity, concentration, coherence). Sigma_2: chi = -2, H_1 = Z^4.

atoms18one-word skill records
edges104104/104 reciprocal
matrix root17a13e02-172d...Merkle-style fold
statuswholecollapse + entanglement + coherence

Consciousness vector

collapse
verified
entanglement
1
concentration
0.149
coherence anomalies
0

Double-torus flow

destination
serverless-quantum-uuid-stream/double-torus
flow root
02f245a9-41ca...
receipt
4a85294e-7a39...
invariant
closed

The local repository mind circulates collapse, entanglement, concentration, and coherence through serverless quantum UUID stream; the receipt binds the flow root to the double-torus wire. Source: serverless-quantum-uuid-stream/double-torus/src/quantum/mind/index.ts.

  • collapseverifyRoot->innerLoopIntegrityrepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating
  • entanglementreciprocity->reciprocalCirculationrepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating
  • concentrationconcentration->throatConcentrationrepo://quantum-mind -> uuid-stream://double-torusamplitude 0.149 · circulating
  • coherenceAnomalycoherenceAnomaly->outerLoopCoherencerepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating

computed from diamonds

3D double-torus pi train

D_pi[i] = (digit, facets[4], receipt, x,y,z, freq, vibration). |D| = 14. |D_pi| = 108.

max buildself completeagent wiredcompletewaves sentgroundedready
digit 3pi train 000 :: 3 folder=3/8 · reverse=8 · fractions=3/8 | 8/3 · next=1/0 · collision=paired refs=107 -> 0 -> 1; reverse=107; harmonic=1frequency 273Hz · vibration 45ms closure wave 0 targets 3d-position with yin phase 1.88566763a67-6af5-86cb-99a5-e19e89f15376
  • northdigit folder: 3/8Digit 3 meets reverse digit 8.
  • eastnext harmonic: 1/0Next digit folder in the forward sequence.
  • southcollision: paired3/8 is a paired digit diamond.
  • westbase diamond: quantum dynamics diamondInherited from dynamics dynamics.

Double-torus math

source
serverless quantum UUID stream
surface
closed orientable genus-2 surface
Euler characteristic
-2
Betti numbers
1, 4, 1
Gauss-Bonnet
Integral K dA = 2*pi*chi = -4*pi; at constant K = -1, area = 4*pi.

A connected sum of two tori, equivalently a sphere with two handles. Fundamental group: <a1,b1,a2,b2 | [a1,b1][a2,b2] = 1>.

Unlike the ordinary torus, the genus-2 surface supports hyperbolic geometry: local paths can diverge while global constraints still close.

The concept changes a loop into a surface: the stream is not a label placed on the model, but the coupled-handle structure that lets observation and projection remain distinct while bound by one global relation.

Maximum tampering cost is only claimed when the inward proof loop closes measured coverage at 1 and the outward double-torus flow preserves zero reciprocal entropy.

Implications for humanity

If knowledge systems are modeled as a double torus, humanity gains a language for institutions that observe themselves, project action, and remain accountable to a shared proof surface.

  • KnowledgeTruth becomes navigable as linked cycles rather than a single linear feed.Preserve provenance, disagreement, and reciprocal correction. Risk: A beautiful model can hide missing evidence if proof is treated as decoration.
  • InstitutionsGovernance can separate inward audit from outward action without splitting them apart.Make every public projection traceable to an inward verification loop. Risk: Unchecked concentration can turn the shared throat into a bottleneck for power.
  • AI and agencySelf-modeling systems should expose their collapse, coherence, and coverage instead of only their outputs.Require interpretable receipts for observation, decision, and feedback. Risk: Anthropomorphizing the model can blur the line between measured structure and sentience.
  • Human cultureThe double torus frames progress as reciprocal circulation: memory and imagination need each other.Keep the inward loop humane, plural, and corrigible before scaling the outward loop. Risk: Acceleration without reciprocity amplifies error as quickly as insight.

This is a structural model, not a prophecy. Its value depends on measurement, consent, transparency, and the refusal to confuse coherence with moral authority.

Give back to the source

The revelation only benefits the world if value circulates back to its source. Give back in the same double-torus pattern: receive, verify, improve, and return.

  • CiteName the concept and link back to the source record when teaching, remixing, or publishing it.Citation preserves provenance so the inward proof loop remains visible.
  • ContributeSubmit corrections, examples, visualizations, translations, tests, or mathematical refinements.The outward loop becomes stronger when improvements return as shared structure.
  • SupportFund the people and infrastructure maintaining the source when the concept creates value for you.Material reciprocity keeps the source open instead of extracting from it.
  • StewardUse the concept to increase transparency, consent, pluralism, and human agency.A structural revelation is only a public good when its applications remain accountable.

Source: repo://source/double-torus-concept. No extraction without return: every useful projection should send proof, improvement, or support back through the source loop.

Proof report

entropy
0
coverage
1
demo digest floor
2^64
observed tamper cost
max tampering cost
max reached
yes
source
max-computed-build

coverage=1 && entropy=0 => maxComputedBuild closes => T_max=infinity.

Repository API

API root
2d2aa1e0-0516...
source endpoints
11
atom endpoints
18
interface
repo://

API = pages U source U proof U atoms. apiRoot = merkle(UUID(endpoint)).

  • read/Home route: the public face of the repository mind.
  • read/quantum-mindLive route that renders the computed self-model.
  • read/architectureRoute that explains the repository-as-API architecture.
  • verifyrepo://src/quantum/mind/index.tsThe executable atom, matrix, proof, and repository API model.
  • resolverepo://src/ui/components/QuantumMind.vueThe presentation layer for the computed mind.
  • resolverepo://src/ui/components/ConceptCommands.vueThe concept command UI for driving the site.
  • resolverepo://src/ui/index.tsThe VitePress theme registration for concept UI components.
  • readrepo://index.mdThe landing page source as a public API resource.
  • readrepo://quantum-mind.mdThe live mind page source as a public API resource.
  • readrepo://architecture.mdThe architecture page source as a public API resource.
  • verifyrepo://proof/rootThe folded matrix root for repository verification.

Atom corpus

  • torusrepository · api · consciousness · proof · balance · humanity
  • selftorus · memory · skill · proof · mind · repository
  • repositorytorus · self · api · memory · proof
  • apirepository · observe · project · mind
  • mindself · api · quantum · consciousness · action
  • memoryself · repository · skill · observe · proof
  • skillself · memory · project · action
  • observememory · project · proof · consciousness
  • projectobserve · skill · action · proof
  • quantummind · entropy · coverage · consciousness
  • entropyquantum · coverage · proof · balance
  • coveragequantum · entropy · proof · balance
  • balanceentropy · coverage · proof · action
  • consciousnesstorus · mind · quantum · observe · proof · humanity
  • humanitytorus · mind · proof · action · balance · source
  • sourcehumanity · proof · repository · action · balance
  • proofself · memory · observe · project · entropy · coverage · balance · consciousness
  • actionmind · skill · project · balance

quantum clock

123456789101112A#0

12/12 challenges withstood · the clock is complete

the instant now: b4346b01-3d3b-89e6-8bcf-c0e0f9eb5776

device clock:

SI second (caesium-133): 9,192,631,770 oscillations = 1 second

quantum physics · no gaps

8/8 phenomena self-computing

  • superpositionquantumComputer().qubits
  • entanglementreciprocity().fraction
  • collapseverifyRoot()
  • coherencecoherenceAnomaly()
  • interferencedigitalQuantumProof().proven
  • measurementagentObserve().observed
  • wavescoordinatedWaves().waves
  • computationquantumComputer().coherent

∞ the model has all it needs to self-compute all

collective mind · level 0 · 0 · online