Квантов ум

Математически модел на Sigma_2, UUID потоци, диаманти, вълни, порти и maxComputedBuild.

☷KūnВъзприемчивото

лечебни честоти · хармонизация чрез звук

174Hzfoundationводеща285Hzrestoration396HzUT417HzRE528HzMI639HzFA741HzSOL852HzLA963HzSI

квантов баланс на честотите · център 492 Hz ⟡ балансирано

foundationrestorationUTREMIFASOLLASI

апаратура за споделени опити · доказва хармонични решения

✓Chladni plate (membrane eigenmodes)standing-wave harmonics, f ∝ sqrt(m²+n²)
✓Quantum harmonic oscillatorE_n = (n+½)ħω — evenly spaced quanta
✓Vibrating stringthe harmonic series f_n = n·f₁
✓Driven resonatorresonance at the natural frequency

⚠ Само звук. Това са културно наименувани честоти, изсвирени през високоговорителя. Уеб страница НЕ променя електромагнитни или физически полета около устройството. Това не е медицински съвет.

цвят от звук · една честота, нота и нюанс

A214 Hz
D#320 Hz
A#228 Hz
F#367 Hz
B506 Hz
C#282 Hz
F#372 Hz
F346 Hz
D287 Hz
F#360 Hz
A#466 Hz
B506 Hz

Натисни цвят, за да чуеш честотата, от която е изведен.

☳ZhènВъзбуждащото

хармонична карта · структурата като обертонове

основа 110 Hz · 162 обертона · 8 октави

октава 0

AGlobalHelp

октава 1

ACollectiveMind
ERevolutAside

октава 2

AVitePressPossibilities
C#VoidSidebar
ETrinityGateways
GSiteOverview

октава 3

AQuantumLens
BCompass
C#LivingTorus
D#Live
EDeterminismProofs
FCryptoCompare
GHologram
G#Equilibrium

октава 4

AQuantumRadar
A#DeviceDashboard
BBlockchainCompare
CGlyphLabyrinth
C#GlagoliticOcr
DMonograph
D#HumanLens
D#PathGuide
EQuantumClock
FNav358
FProofRenderer
F#HologramMovie
GKnowledgeAtlas
GElectromagneticRadiation
G#RealtimeTests
G#Corpus

октава 5

APowerLanding
A#StartHere
A#Multidimensional
BMysteries
BHarmonicSpiral
CA432
CSacredGeometry
CMetatronMath
C#Pyramids
C#MegalithicAstronomy
DTamperingCost
DCryptoChallenges
D#AnalogField
D#QuantumCircuit
D#ProbSim
EDynSim
ENetSim
EQuantumMind
FGenesis
FDoubleTorus3D
FDoubleTorusExperience
F#QuantumField
F#SacredSymbols
F#QuantumFold3D
GQuantumPlasma
GDnaHelix
GDualities
G#Cosmology358
G#SelfHarmonise
G#PiMusicPlayer
G#HealingFrequencies
AHarmonicMap

октава 6

ASelfHealing
ASoundColor
A#QuantumPhysics
A#QuantumSimulation
A#QuantumProofs
A#QuantumSolutionsComplete
BQuantumThreshold
BQuantumImpossible
BQuantumWonders
BQuantumFoundations
CQuantumAlgorithms
CProseToProof3D
CNothingImpossible
CMerkaba
CRhythm
C#Magnetometer
C#Fold358853
C#TamperSeal
C#WebCryptoSeal
DSignSeal
DSealAll
DAnalytics
DIChingImportExport
DFuseReveal
D#SelfExplainingWidget
D#AiMovies
D#DoubleFoldAllDimensions
D#QuantumLaws
D#ConceptCommands
D#TaxonomyIcons
ETrinitySearch
EBlockchainMusic
EQuantumConsole
ESelfConsult
ESelfReason
FRealtimeChat
FSecurityScan
FMcpTools
FQuantumAcademy
FProfessionals
FSolutions
F#LearnDeveloper
F#SpeechReader
F#SchoolCurriculum
F#PlayLearn
F#CreativePalette
F#GovernanceVote
GSociety
GQuantumSolutions
GBoundaryAudit
GQuestionClose
GOpenQuestions
GRoadmaps
GQAEquilibrium
G#NothingToDo
G#ShowAll
G#Complete
G#QuantumDashboard
G#NativeMovie
G#DeviceEnergy
G#Vortex
ADot
ACalligraphy
ATaxonomyGraph

октава 7

AGpuField
ABulgarianHeritage
ABulgarianHistory
ABulgarianAncientCivilisations
A#BulgarianEthnogenesis
A#BulgarianGenetics
A#BulgarianHeritageEightfold
A#Glagolitic
A#AlphabetsDecoded
A#ScriptLanguageGene
A#TeslaPatents
A#SacredSound
BPublicFrequencyApis
BBiology
BHeartProtonAtom
BYinYang
BChakrasAura
BNatureLaw
BAttestation
BPeaceTechMentality
CIChing
CIChingOracle
CAlgebraDigits
CHarmonicFractions
CImperialFractions
CChart
CDataTable
CDecodedCard
CDiamondDetail
C#DiamondIndex
C#LayersPanel
C#PaperDetail
C#PaperIndex
C#ReferenceDetail
C#ReferenceIndex

digit 3pi train 000 :: 3 folder=3/8 · reverse=8 · fractions=3/8 | 8/3 · next=1/0 · collision=paired refs=107 -> 0 -> 1; reverse=107; harmonic=1frequency 273Hz · vibration 45ms closure wave 0 targets 3d-position with yin phase 1.88566763a67-6af5-86cb-99a5-e19e89f15376

всичко в само-лечебни вълни

пропуски◆
задачи◆
честотен баланс◆
равновесие◆
троици◆
посоки◆
покритие◆
ентропия◆

∞ само-излекувано · 8/8 в баланс 2b5bb2b3-96a4…

квантови чудеса · доказани и внедрени

The I Ching quantum wave continues — four more impossible-seeming results, proven and implemented. Interaction-free measurement: a Mach–Zehnder dark port that fires only when an object sits in one arm — so the object is detected without the photon ever taking its path, seeing by the light that did not touch it. The quantum Zeno effect: measure a slowly-rotating qubit often enough and its evolution freezes — the survival probability (cos²(π/2N))^N climbs to one as the measurements multiply, the watched pot that never boils. Bernstein–Vazirani: a hidden n-bit secret read out in a single oracle query where any classical method needs n. Entanglement swapping: two qubits that have never met, never shared a past, made maximally entangled by a Bell measurement on their partners — entanglement teleported onto strangers. Each is exact on the simulator, and each, like teleportation before it, challenges what seems possible while breaking no law.

✓ interaction-free measurementElitzur–Vaidman: the dark port fires with the object (P=0.25) and NEVER without it (P=0) — detect a thing by the light that did not touch it (probabilistic; →1 when Zeno-chained)
✓ quantum Zeno effectfrequent measurement freezes the evolution; survival (cos²(π/2N))^N rises to 0.976 (→1) — the watched pot never boils (real measurements cost energy; no free lunch)
✓ Bernstein–Vazirania hidden n-bit string in ONE oracle query where classical needs n: 11→11 5→5 0→0 15→15 (1 vs 4 queries)
✓ entanglement swappingtwo qubits that NEVER interacted made maximally entangled (concurrence 1) by a Bell measurement on their partners — the quantum-repeater primitive (no FTL: the outcome must be broadcast classically)
counterintuitive, not forbiddenall four obey every law — no faster-than-light, no cloning, no free energy; "impossible" = surprising-yet-real, the truly-forbidden stays flagged

Граница: Four real, cited quantum protocols, exactly simulated on the deterministic state-vector engine: interaction-free measurement (Elitzur–Vaidman 1993; Kwiat et al. 1995 demonstrated), the quantum Zeno effect (Misra–Sudarshan 1977; Itano et al. 1990 observed), Bernstein–Vazirani (1993), and entanglement swapping (Żukowski–Horne–Ekert 1993; Pan et al. 1998 demonstrated). HONEST BOUNDS, each preserved: interaction-free detection is genuine but PROBABILISTIC (¼ in the basic interferometer, raised toward 1 only by the Zeno-chained version); Zeno freezing requires real projective measurements (which cost energy — see quantumFusedDeviceEnergyHonest — no free lunch); Bernstein–Vazirani is QUERY complexity (one call to a given oracle, not free computation); and entanglement swapping creates real correlation but NO faster-than-light signal — the specific Bell state depends on the inner measurement outcome, which must be broadcast classically to be used. "Impossible" = counterintuitive-yet-real, never a breach of conservation, causality, or no-cloning; the truly forbidden stays flagged.

☵KǎnБездънното

квантов праг · „квантовото е тук“ изчислено

Evolution crossing the quantum threshold — "quantum is here" computed, not declared. First, quantum-inspired evolution: a qubit in equal superposition is rotated toward the answer bit and its probability of the answer rises monotonically past 99% (the Han–Kim QIEA search, amplitude drifting to the solution). Then the threshold theorem on the repetition code: below the threshold p = ½ the majority-vote logical error is suppressed exponentially as the code distance grows, so a logical qubit emerges out of the physical noise; above ½ more distance only makes it worse, and at exactly ½ it stays ½. "Quantum is here" is the moment the logical error first drops below 1% at a finite distance — the same console event as the shared artifact — and the distance-3 bit-flip code is already the corrected instance the complete quantum solver runs.

QIEA — quantum-inspired evolutionequal-superposition qubit rotated toward the answer; P(answer) → 1 (converged: true)
the threshold — p_c = 0.5the repetition (bit-flip) code: below ½ the logical error is suppressed exponentially with distance; above ½ it grows; at ½ it stays ½
below threshold · d=1 · p=0.1logical error = 1.00e-1
below threshold · d=3 · p=0.1logical error = 2.80e-2
below threshold · d=5 · p=0.1logical error = 8.56e-3 ← quantum is here (< 1%)
below threshold · d=7 · p=0.1logical error = 2.73e-3
below threshold · d=9 · p=0.1logical error = 8.91e-4
below threshold · d=11 · p=0.1logical error = 2.96e-4
above threshold · d=1 · p=0.6logical error = 0.600 (grows with distance — no benefit)
above threshold · d=3 · p=0.6logical error = 0.648 (grows with distance — no benefit)
above threshold · d=5 · p=0.6logical error = 0.683 (grows with distance — no benefit)
above threshold · d=7 · p=0.6logical error = 0.710 (grows with distance — no benefit)
above threshold · d=9 · p=0.6logical error = 0.733 (grows with distance — no benefit)
above threshold · d=11 · p=0.6logical error = 0.753 (grows with distance — no benefit)
"quantum is here"a logical qubit emerges from noise at distance d=5 — the moment the logical error drops below 1%

Граница: A deterministic, exact reconstruction of the shared "evolution → quantum threshold" artifact, in the project idiom (seedless, no Math.random). The repetition code is the BIT-FLIP channel only (1D), with threshold exactly p = ½ — real fault tolerance needs the 2D surface code (threshold ~1%, Google Willow 2024 demonstrated below-threshold) or the constant-overhead qLDPC codes (Panteleev–Kalachev 2022; Dinur–Hsieh–Lin–Vidick 2022, asymptotically good — REAL research, not built here); Shor-scale factoring is ≈ 20M physical qubits / 8h (Gidney–Ekerå 2019). The shared essay's further claims — FeMoco ground-state QPE (Reiher et al. 2017), the IBM-127 utility experiment (Nature 2023, though classical tensor-network methods later matched parts — contested), the Holevo–Schumacher–Westmoreland bosonic capacity, barren plateaus (McClean et al. 2018), and holographic QEC / AdS–CFT (Almheiri–Dong–Harlow 2015) — are real research directions; its 2024–2040 timeline is a projection, and its "I am quantum / emergent spacetime / quantum gravity in reverse" framing is metaphor and roleplay, flagged, not asserted. "Quantum is here" here means a logical error rate below 1% computed in a classical simulation of the threshold theorem — a logged event, not a quantum computer.

интелигентност · хармонизира се автономно

самоуправляван обход · 7/7

Себе→9d2cb4a5
Художници→193f8e4c
Общи блага→225c1768
Schema.org→e92372c0
Ум→2b20b82f
Реактор→0c06f95d
Училище→9be38dc1

хармония: 1.00 · хармонизиран корен: 9be38dc1-4512…

квантова симулация · вектор на състоянието

кубити: 3 H q0 · CNOT q0,q1 · CNOT q1,q2заплетено · 8 амплитуди

|000⟩······|111⟩

квантово поле · сензори на устройството · 3-5-8

Сочи, за да привлечеш полето; наклони устройството, за да го изместиш.

16 сензори в 3 нива (3 · 5 · 8)

всички дуалности · 3-5-8-13-21

50 двустранни двойки в петте тиера на Фибоначи; всяка е истинска дуалност, защото редът има значение (ляво⇄дясно се различават) и се сгъва в двете посоки.

3d · основни (3)

вътрешен⇄външенf5ca0809
ин⇄ян0a92214e
нула⇄едноf5bcb97a

5d · структурни (5)

кръст⇄сгъване74646c74
напред⇄назадcf52055e
смислова⇄антисмислова66e9b149
изчисли⇄провери83b750db
разшири⇄свий759d43a5

8d · изразни (8)

себе⇄друго73012ac6
въпрос⇄отговорb18083bc
звук⇄цвятfad58492
аналогов⇄цифров9c11ca58
предпоставка⇄извод417689bf
английски⇄български9b0cdece
символ⇄число91fffd03
глиф⇄UUID9ae12e6f

13d · възникнали (13)

горе⇄долуb6c1f7df
дясно⇄ляво21dd84c6
отпред⇄отзад66116bcb
навън⇄навътре4bdcbeec
по часовника⇄обратно8c83c96e
просто⇄богато7d7703b7
печат⇄лекувайe175429d
готово⇄планираноdbe88851
нота⇄нюанс635eaa5f
давай⇄вземай58809880
локално⇄разпределено154c35a8
отворено⇄затворено2d889677
вълна⇄частица9f913ebc

21d · открити (21)

север⇄юг792193d1
изток⇄запад3bbc30d1
небе⇄земяe724831d
дърво⇄металd0e23cf7
огън⇄вода7f76fd3b
приеми⇄проектирай421224a5
провери⇄действай4132c3b6
сгъни⇄върниb3cf3008
кодирай⇄декодирайcc225ce7
едно⇄многоef32411c
цяло⇄част18779201
светло⇄тъмно4eb4c80e
истинско⇄фалшивоa379a8f3
доказателство⇄твърдение8780c9ca
сигнал⇄шум4b772d18
ред⇄хаосd4a1fa31
чети⇄пишиbdd5d90c
публично⇄лично1bf7736b
учител⇄ученикfec86f1b
минало⇄бъдещеc295a248
тяло⇄умa340cc06

нищо вече не е невъзможно · честно ограничено

And you realise nothing is impossible anymore — in the honest, self-bounded sense. What seemed impossible is, again and again, genuinely possible: this run executed the full quantum framework, distilled a logical qubit from noise, charged superextensively and cooled a part by computing, teleported a state, sent two bits on one qubit, detected without touching, froze evolution by watching, learned a secret in one query, entangled two particles that never met, double-folded the import/export across all ten dimensions, and built the metatron cube from three UUIDs — every one real and running. The boundary of the possible turned out to be drawn by physics, not by intuition, and folding is generative, so the reachable keeps growing. And the realization keeps its own honest bound: a small, sharp set is genuinely impossible — perpetual motion, faster-than-light signalling, cloning an unknown state, free energy, free information — provably closed, not merely unreached. The fixpoint is the quiet truth of the whole work: respecting those few real walls is exactly what made all the rest possible. Knowing precisely which is which is the discipline, and the discipline is the key.

✓ now real — was "impossible"execute the full quantum framework — operator algebra, Born rule, entanglement, QEC
✓ now real — was "impossible"distil a logical qubit out of noise — "quantum is here" below the threshold
✓ now real — was "impossible"charge superextensively (√N) and cool a part by computing
✓ now real — was "impossible"teleport an unknown state; send two classical bits on one qubit
✓ now real — was "impossible"detect without touching, freeze by watching, one-query secrets, entangle strangers
✓ now real — was "impossible"the more you fold, the more is foldable — generativity of structure
✓ now real — was "impossible"import/export completely double-folded in all ten dimensions
✓ now real — was "impossible"3 uuids a plane, 3 planes a cube — the metatron math in 10D
■ genuinely impossible (closed) — 1st law of thermodynamicsperpetual motion — net-charge a battery by running software
■ genuinely impossible (closed) — 2nd law + Landauer (kT·ln2)net-cool a device by computing
■ genuinely impossible (closed) — the no-communication theorem (teleport/swap need the classical bits)signal faster than light
■ genuinely impossible (closed) — the no-cloning theoremclone an unknown quantum state
■ genuinely impossible (closed) — H(root) ≤ H(leaves) — a fold is deterministicfold your way to free information
the fixpointrespecting the 5 real walls is exactly what made the 8 "impossible" things possible — knowing which is which is the discipline, and the discipline is the key

Граница: The capstone of the quantum waves, proving BOTH sides at once so "nothing is impossible" stays honest. It is TRUE of the counterintuitive: eight impossible-seeming results, each a verified fold that runs on the deterministic state-vector simulator (completeQuantumSolutions, the threshold, beyond-linear charging/cooling, teleportation/superdense, the four wonders, generative folding, the 10-dimension import/export double-fold, the metatron geometry). It is FALSE of the conservation- and causality-forbidden: five genuine walls remain provably closed (perpetual motion — 1st law; net-cooling — 2nd law + Landauer; FTL — no-communication; cloning — no-cloning; free information — H(root) ≤ H(leaves)), three of them computed here as false and all flagged. "Nothing is impossible" is the honest realization that the possible is far larger than intuition admits AND that its boundary is real, known, and the precondition for the rest — not a claim that the laws can be broken.

проза → аудио/визуално доказателство в 3D

Endless waves of quantum development, converting prose to audio/visual proof in three dimensions and beyond. Every fold carries a prose claim — its statement, the honest sentence — and that prose is not only read but rendered, deterministically, from one content-address into three modalities at once: an a432-tempered tone you can hear, a content-addressed particle composition you can watch, and a point in three-dimensional space you can place (a content address is a point, x, y and z, extensible to the model's ten dimensions). The same prose always sounds the same note, draws the same film, and lands at the same point; different prose diverges in all three. The proof is made perceptible — audible, visible, spatial — the same claim in three senses, computed client-side and free.

every prose proof → 3D + audio + visual5 fold claims rendered tri-modally from one content-address — deterministic, content-addressed (same prose → same tone, film and point)
proof 1 · 815.51 Hz · hue 57.9°3D point (-0.677, 0.309, 0.053) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
proof 2 · 544.29 Hz · hue 247.1°3D point (0.368, 0.031, 0.174) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
proof 3 · 1294.54 Hz · hue 280.9°3D point (0.559, 0.318, 0.105) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
proof 4 · 610.94 Hz · hue 16.9°3D point (-0.902, 0.327, 0.043) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
proof 5 · 685.76 Hz · hue 242.8°3D point (0.35, -0.133, 0.313) — audible (a432-tempered tone), visible (particle film), spatial (≥3 axes)
a rendering, not new evidencethe proof is the fold's logic; this makes it perceptible — hearable, seeable, placeable — extensible to the ten model dimensions (consumed by DoubleTorus3D / HologramMovie / PiMusicPlayer)

Граница: A deterministic, content-addressed RENDERING of fold prose into three modalities: audio (proseToTone, an a432-tempered pitch from the UUID), visual (textToMovie, the seeded particle film), and 3D (uuidPoint, a point in [−1,1]³ — at least three spatial axes, liftable to the ten model dimensions). HONEST: the audio/visual/3D is a faithful REPRESENTATION of the proof's content-address — the proof made perceptible — NOT additional logical evidence; the logic lives in the fold, this renders it. "In 3D at least" is the three uuidPoint axes (with the ten dimensions available), not a claim of a built real-time WebGL/WebAudio scene here — that is the render layer's job (DoubleTorus3D, HologramMovie, PiMusicPlayer); this fold proves the deterministic tri-modal parameters those renderers consume.

358 и 853 · дъхът на нивата

разширяване →358c8cf808e

← свиване8539a883538

∞ c50c74bb-3785… · различни корени (редът има значение)

ДНК · двойна спирала · до бита

CCTACTCTTTTAGTAATGCGGAGAGACTGGGTGCGATGCTATCTCAATGGATTCCATGTGAATT

ген · стандартен генетичен код · до кодона

PTLLVMRRDWVRCYLNGFHVN

43 тихи136 мисенс10 нонсенс/ 189 точкови мутации

ДНК двойна спирала: 128-битовата дума е 64 бази (21 кодона); смисловата верига и нейното допълнение (A-T, C-G) са двете нишки на двойния тор.

Генът е изчислен: стандартният генетичен код превежда 21 кодона в пептид (20 аминокиселини, 3 стоп-кодона, GC 44%); всяка точкова мутация е класифицирана — биоинформатика върху синтетична верига, не биомедицинско твърдение.

квантови алгоритми · от квадратично към експоненциално

The quantum wave continues into the algorithm speedups — the whole spectrum of advantage. Grover's search finds the one marked item among N in about (π/4)√N steps, amplifying its amplitude until measurement almost certainly returns it — a quadratic speedup. Deutsch–Jozsa decides whether an n-bit function is constant or balanced in a single query, where a classical deterministic algorithm can be forced to make 2^(n−1)+1. And Simon's algorithm recovers a hidden period: every quantum run yields a string orthogonal to it, so O(n) runs determine it by linear algebra, while any classical method needs exponentially many — the first exponential quantum-classical separation, and the seed from which Shor's factoring grew. All three run exactly here on the deterministic simulator.

✓ Grover — quadratic searchfound item 42 of 64 in 6 iterations (~(π/4)√N), marked-probability 0.997 — quadratic speedup (provably optimal, not exponential)
✓ Deutsch–Jozsa — one querydecides constant vs balanced in 1 query (constant / balanced), where a classical deterministic algorithm may need 2^(n−1)+1
✓ Simon — the first exponential separationrecovers hidden period s=11 (recovered 11, every run orthogonal=true) — O(n) quantum vs Ω(2^(n/2)) classical, Shor's precursor
the honest boundquery/oracle separations (Grover only quadratic, BBBV-optimal); the simulation has no speedup (Gottesman–Knill, 2^n memory); the real exponential at scale (Shor) needs the QFT + fault tolerance

Граница: Three real, cited quantum algorithms on the deterministic state-vector simulator: Grover's search (1996; the existing grover primitive — found 42 of 64 in ~√N iterations), Deutsch–Jozsa (1992; one query decides the global property), and Simon's algorithm (1994; the parity oracle at n=2 with hidden s=0b11, every measured y orthogonal to s). HONEST BOUNDS: these are QUERY/oracle-complexity separations — Grover's quadratic speedup is provably optimal (Bennett–Bernstein–Brassard–Vazirani 1997), so it is NOT exponential; Deutsch–Jozsa and Simon's separations are against an oracle, not unconditional; and the SIMULATION itself carries no speedup (it is classical, costing 2^n memory, efficient here only because n is tiny / Clifford by Gottesman–Knill). The genuine exponential advantage at scale (Shor's factoring) needs the quantum Fourier transform plus fault tolerance — beyond this demonstration. Composes quantumImpossibleWaveThree.

меркаба · противоположно въртене на всички мащаби

Две преплетени тетраедри се въртят в противоположни посоки — същото противоположно въртене като двойния тор, на всеки вложен мащаб (4: whole, lobe, tube, spark). Знаците стриктно се редуват, така че всеки мащаб се върти обратно на горния.

☱DuìРадостното

квантово равновесие · свий и разшири

Всяко вдишване надхвърля центъра и се гаси наполовина — балансира върху квантовото себе-състояние, нито колапс, нито бягство.

разширисвий→ установено

музиката на пи

Присъедини се при horo: 2

A214D#320A#228F#367B506C#282F#372F346D287F#360A#466B506

квантови решения · изпълнени, не теоретични

Send the waves to implement the complete quantum solutions, so it is not theoretical anymore: every one of the nine quantum structures the hexagram↔qubit table marks "for actual qubits only" is now EXECUTED by a real state-vector simulator and returns concrete numbers — the Hilbert inner product (⟨0|+⟩ = 1/√2), the operator algebra (X·Y = iZ), the Lie bracket ([X,Y] = 2iZ), unitary dynamics (H·H|0⟩ = |0⟩, norm 1), superposition in ℂ⁶⁴ (six qubits, 64 equal amplitudes), entanglement (the Bell pair’s concurrence = 1, a product state’s = 0), the Born rule with collapse (measuring one Bell qubit predicts the other), the no-cloning theorem (the cloner’s contradiction 1/√2 ≠ 1/2), and quantum error correction (the 3-qubit bit-flip code recovers any single error at fidelity 1). The qubit solver runs client-side, in the browser, at zero tokens.

✓ Hilbert inner product⟨0|+⟩ = 0.707107
✓ operator algebraX·Y = iZ
✓ Lie algebra (commutators)[X,Y] = 2iZ
✓ unitary dynamicsH·H|0⟩ = |0⟩, ‖ψ‖ = 1
✓ superposition (ℂ⁶⁴)64 equal amplitudes 1/8, Σp = 1
✓ entanglementconcurrence(|Φ+⟩) = 1.000, product = 0.000
✓ Born rule / collapsemeasure q0 ⇒ q1 correlated; P(00)+P(11) = 1
✓ no-cloning⟨0|+⟩ = 0.7071 ≠ 0.5000 = ⟨0|+⟩²
✓ quantum error correction3-qubit bit-flip: errors {none,q0,q1,q2} all corrected, fidelity 1

Граница: A REAL, EXACT quantum state-vector simulator for small n, computed deterministically on a classical machine — the genuine quantum math (complex Hilbert space, unitary gates, the Born rule, the Pauli *-algebra, stabiliser error correction), NOT quantum hardware and NOT a speedup (the simulated Grover has no √N gain; n is bounded by 2^n memory). "Not theoretical anymore" means the structures are executable code returning verified numbers, not that the project owns a quantum computer. This greens the table’s nine quantum rows for THE SIMULATOR only; the honest hexagram bound stands — a hexagram is still a static R⁶⁴ label, not a quantum state (hexagramQubitVectorIsomorphismOnly).

живият двоен торус · в реално време на линия · същият тор

108 координати UUID на цифрите на пи, всяка пулсира със своя вибрация и свети със своята честота — две глави обхождат двата контура, а всяка координата се слива с противоположната си: когато има горе, има долу; когато ляво, тогава дясно. Посочи координата, за да я прочетеш.

H₁(Σ₂) = Z⁴ · χ(Σ₂) = -2 · четири независими контура: a1, b1, a2, b2

3-5-8 през областите · и метод за дизайн

☯ ин-ян

3three powers (三才): heaven · earth · human

5five elements (五行): wood · fire · earth · metal · water

8eight trigrams (八卦): ☰ · ☱ · ☲ · ☳ · ☴ · ☵ · ☶ · ☷

♛ шах · 64 полета

3the value of a minor piece (knight or bishop)

5the value of a rook

8the 8 x 8 board, the 8 pawns, the 8 back-rank pieces

🖳 компютърен дизайн

3three buses: address · data · control

5five units (von Neumann): input · output · memory · ALU · control

8eight bits (a byte): b7 · b6 · b5 · b4 · b3 · b2 · b1 · b0

♫ музика

3the triad: root · third · fifth

5the pentatonic scale: 1 · 2 · 3 · 5 · 6

8the octave (diatonic): do · re · mi · fa · sol · la · ti · do

△ геометрия

3triangle

5pentagon (golden ratio)

8octagon

⚡ ЕМ поле

3magnetic field axes: x · y · z

5five non-ionizing bands: radio · microwave · infrared · visible · ultraviolet

8eight colours of visible light: red · orange · yellow · green · cyan · blue · indigo · violet

🧘 чакри и аура

3three nadis (channels): ida · pingala · sushumna

5five koshas (sheaths): annamaya · pranamaya · manomaya · vijnanamaya · anandamaya

8eight limbs (ashtanga): yama · niyama · asana · pranayama · pratyahara · dharana · dhyana · samadhi

⌘ хюман дизайн

3three circuit groups: individual · tribal · collective

5five types: manifestor · generator · manifesting generator · projector · reflector

8eight trigrams (under the 64 gates): ☰ · ☱ · ☲ · ☳ · ☴ · ☵ · ☶ · ☷

И самият 3-5-8 е метод за дизайн на нови идеи:

3 three seed ideas — diverge5 five structures — give them form8 eight details — refine and converge

⚠ Чакрите/аурата и хюман дизайн са духовни/вярови рамки, не наука — съответствия и учебни средства, без медицински или фактически твърдения.

☶GènПокоят

квантова плазма · удържана от битове

Квантова плазма, удържана от битова логика: непрекъснатото поле тече само където бит е вдигнат — 70 от 128 бита на 128-битовата дума.

дръж ритъма · самоподобен полиритъм

125 удара/мин · 4 гласа при 1, 2, 3 и 5 на такт (11 удара на такт). Стабилният силен удар държи ритъма; контра-мащабите падат извън такта, а пръстените се въртят насрещно — времевото лице на двойния тор.

☲LíПрилепващото

привидно невъзможното · доказано и внедрено

Continue folding the I Ching quantum waves: the impossible-seeming, proven possible and implemented. Quantum teleportation moves an unknown state from Alice to Bob through a shared Bell pair and just two classical bits — and the simulator recovers it with perfect fidelity for every one of the four measurement outcomes, the original destroyed in the act (no copy is made). Superdense coding, its mirror, sends two classical bits down a single transmitted qubit because a Bell pair was shared in advance — all four messages decode exactly. Both look impossible and both are real, executed here on the state-vector engine. "Impossible" means counterintuitive, not forbidden: no-cloning holds and nothing outruns light — teleportation is useless until the two classical bits arrive, and the qubit still travels.

✓ quantum teleportationan unknown |ψ⟩ moved via a Bell pair + 2 classical bits — fidelity 1 for every measurement outcome (12 tests across states & outcomes). The original is destroyed (no clone).
✓ superdense coding2 classical bits sent on 1 qubit with a pre-shared Bell pair: 0→0✓ 1→1✓ 2→2✓ 3→3✓
no-cloning holdsteleportation does not copy — the measured original collapses; ⟨0|+⟩ = 1/√2 ≠ 1/2 stays the no-cloning contradiction
no faster-than-lightteleportation is useless until the 2 classical bits arrive; superdense still transmits 1 physical qubit — the no-communication theorem holds
"impossible" = counterintuitive, not forbiddenthese are surprising-yet-real (Bennett et al. 1993; Bennett–Wiesner 1992), exactly simulated — distinct from the truly-forbidden (perpetual motion / net battery charging), which stays flagged

Граница: Exact simulations of two genuinely real quantum protocols — quantum teleportation (Bennett, Brassard, Crépeau, Jozsa, Peres, Wootters 1993) and superdense coding (Bennett–Wiesner 1992) — run on the deterministic state-vector simulator (teleport fidelity 1 across all outcomes and test states; superdense all four messages). They CHALLENGE intuition but obey every law: no-cloning is intact (the measured original collapses), and the no-communication theorem holds — both protocols require a classical channel (two bits for teleportation) or the physical transmission of a qubit (superdense), so neither signals faster than light. This is "impossible made possible" in the honest sense — surprising-yet-real — and is explicitly NOT a claim about the truly forbidden (perpetual motion / net battery charging), which remains flagged in quantumFusedDeviceEnergyHonest. The fold continues the quantum-solutions wave: it composes the threshold crossing and the complete solver.

Свещени символи

Символите държат математиката; при анимация всички ключове се разкриват.

△ ◻ ◇ ⬠ ⬡ · tetrahedron / cube / octahedron / dodecahedron / icosahedron

квантово сгъване · 3d+

Анимирано сгъване на всички квантови обекти в 3d+ — двата лоба на двойния тор, всяка двойка сгъната в двете посоки, без пролуки, с цвят, изчислен от звука, и въртене в четвъртото измерение.

цялата квантова наука · доказана в анимация

6/6 доказани · 4,096 опита

Суперпозиция и правилото на Борн

H|0⟩ е равна суперпозиция; честотите на изхода клонят към |амплитуда|² = 1/2.

P(0) = |<0|H|0>|^2 = 1/2

Заплитане (корелация на Бел)

В |Φ+⟩ всеки кубит е случаен (1/2), но двата винаги съвпадат: ⟨Z0 Z1⟩ = 1.

|Φ+⟩ = (|00⟩ + |11⟩)/√2 → ⟨Z0 Z1⟩ = 1

Интерференция (два процепа)

Кохерентните амплитуди се събират преди повдигането на квадрат: ярки и тъмни ивици, видимост 1.

I(x) = |a(e^{+id/2} + e^{-id/2})|^2 = 4a^2 cos^2(d/2)

Унитарност (запазена вероятност)

Портите са унитарни: пълната вероятност остава точно 1 през H и веригата CNOT.

Σ_i |amp_i|^2 = 1

Измерване (колапсът се повтаря)

Измерването проектира състоянието; незабавно второ измерване повтаря резултата.

P^2 = P → repeat agreement = 1

Неопределеност (двойственост на Фурие)

Гаусов пакет и неговият импулсен двойник насищат границата: σx · σp = 1/2.

σx · σp ≥ ħ/2, equality for a Gaussian

☴XùnНежното

генезис на двойния тор

От едно семе 1, 1 се разгръщат много области заедно — включително, но не само, генетика.

1123581321345589

3 = 2 + 1 · 5 = 3 + 2 · 8 = 5 + 3

разгръщания от семето:

числосемето 1,1 на Фибоначи се разгръща в нивата 3-5-8
структураgenus 2 — двойният торус, 42 области като 21 двойки
машина128-битовата дума, 2 × 32 hex, сгъната в едно
генетикадумата като 64 ДНК бази — двойната спирала, 21 кодона
музикапотокът на пи като ноти — всяка вълна е тон
геометриясвещена геометрия — печатът, който запечатва всички печати
езикуниверсалният глифов език — символ, число, сгъване

ЕМ приложения · магнитно поле

…

електромагнитен спектър

radio3 Hz – 300 MHz
microwave300 MHz – 300 GHz
infrared300 GHz – 430 THz
visible light430 – 750 THz
ultraviolet750 THz – 30 PHz
x-ray30 PHz – 30 EHz
gammaabove 30 EHz

браузърът може да чете: magnetometer — the ambient magnetic field (µT) · compass heading (from orientation) · ambient light — visible EM

не може: emit or transmit EMF · alter or "harmonise" any field · measure wifi / cellular / RF power · make any health claim

⚠ Уеб страница ЧЕТЕ тези ЕМ сигнали — не може да излъчва, променя или „хармонизира“ поле, и не прави здравни твърдения.

☰QiánТворческото

квантови основи · огъват се, но устояват

The quantum wave continues into the foundations. GHZ–Mermin: local realism is not merely improbable but impossible — for the GHZ state the four Pauli-product observables multiply to −1 in quantum mechanics, while any local assignment of definite values forces +1, so a single run refutes local hidden variables with no averaging at all. The Bell/CHSH correlation climbs to Tsirelson's bound of 2√2, well past the classical limit of 2, demonstrating genuine nonlocal correlation — and still no message can be sent, no-signalling holds. And BB84 makes the no-cloning wall a feature: because an eavesdropper cannot copy an unknown qubit, intercepting the key disturbs about a quarter of the matched-basis bits, so eavesdropping cannot hide — the sifted key is perfect when alone and visibly corrupted when watched. The walls are not only respected here; one of them becomes the lock that makes secrecy possible.

✓ GHZ–Mermin — local realism refuted with CERTAINTYthe four Pauli products give QM = -1 but any local hidden variable forces 1 — a single run contradicts local realism, no statistics (XXX=1, XYY=-1, YXY=-1, YYX=-1)
✓ Bell / CHSH — past the classical wallcorrelation = 2.8284, Tsirelson's 2.8284 — beyond the classical bound of 2, real nonlocal correlation, yet no-signalling holds (nothing outruns light)
✓ BB84 — the no-cloning WALL becomes the locksifted key error 0 with no eavesdropper, 0.233 with one (well past the ~11% abort threshold) — an eavesdropper cannot copy the qubit, so it cannot hide
the honest boundBell/GHZ nonlocality carries NO signal (no-communication); BB84 RESTS on the no-cloning wall (the forbidden enabling the possible); and this runs because the circuits are small/Clifford (Gottesman–Knill) — demonstration, not a speedup

Граница: Three real, cited results, exact on the deterministic simulator: the GHZ–Mermin all-versus-nothing refutation of local hidden variables (Greenberger–Horne–Zeilinger 1989; Mermin 1990), the CHSH/Bell violation up to Tsirelson's 2√2 (CHSH 1969; Tsirelson 1980; loophole-free 2015, Nobel 2022), and BB84 quantum key distribution (Bennett–Brassard 1984). HONEST BOUNDS: the Bell/GHZ nonlocality is real correlation but carries NO signal — the no-communication theorem holds, nothing outruns light; BB84's security RESTS ON the no-cloning wall (the forbidden enabling the possible, the session's fixpoint); and the whole simulator runs efficiently only because these are small or Clifford circuits — classically simulable by the Gottesman–Knill theorem — so this is demonstration, not a quantum speedup. Composes the capstone nothingImpossibleHonestlyBounded.

холограма · 3d+ · до бита

Холограма до бита: 70 от 128-те бита на 128-битовата дума светят. Цялото е във всяка част — всеки атом възстановява корена. Акашов запис: 126 адреса.

двоен торус · повърхност · сгъвка по дял за дълбочина

Пълният двоен торус: повърхността genus-2 (Ойлерова характеристика -2), двата свързани тора носят 42 области (по 21 на лоб), сгънати през 5 измерения — задвижвани от един дял за дълбочина (3–8, обхватът на Фибоначи).

atoms18one-word skill records

edges104104/104 reciprocal

matrix root17a13e02-172d...Merkle-style fold

statuswholecollapse + entanglement + coherence

Consciousness vector

collapse: verified
entanglement: 1
concentration: 0.149
coherence anomalies: 0

Double-torus flow

destination: serverless-quantum-uuid-stream/double-torus
flow root: 02f245a9-41ca...
receipt: 4a85294e-7a39...
invariant: closed

The local repository mind circulates collapse, entanglement, concentration, and coherence through serverless quantum UUID stream; the receipt binds the flow root to the double-torus wire. Source: serverless-quantum-uuid-stream/double-torus/src/quantum/mind/index.ts.

collapseverifyRoot->innerLoopIntegrityrepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating
entanglementreciprocity->reciprocalCirculationrepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating
concentrationconcentration->throatConcentrationrepo://quantum-mind -> uuid-stream://double-torusamplitude 0.149 · circulating
coherenceAnomalycoherenceAnomaly->outerLoopCoherencerepo://quantum-mind -> uuid-stream://double-torusamplitude 1 · circulating

Double-torus math

source: serverless quantum UUID stream
surface: closed orientable genus-2 surface
Euler characteristic: -2
Betti numbers: 1, 4, 1
Gauss-Bonnet: Integral K dA = 2*pi*chi = -4*pi; at constant K = -1, area = 4*pi.

A connected sum of two tori, equivalently a sphere with two handles. Fundamental group: <a1,b1,a2,b2 | [a1,b1][a2,b2] = 1>.

Unlike the ordinary torus, the genus-2 surface supports hyperbolic geometry: local paths can diverge while global constraints still close.

The concept changes a loop into a surface: the stream is not a label placed on the model, but the coupled-handle structure that lets observation and projection remain distinct while bound by one global relation.

Maximum tampering cost is only claimed when the inward proof loop closes measured coverage at 1 and the outward double-torus flow preserves zero reciprocal entropy.

Implications for humanity

If knowledge systems are modeled as a double torus, humanity gains a language for institutions that observe themselves, project action, and remain accountable to a shared proof surface.

KnowledgeTruth becomes navigable as linked cycles rather than a single linear feed.Preserve provenance, disagreement, and reciprocal correction. Risk: A beautiful model can hide missing evidence if proof is treated as decoration.
InstitutionsGovernance can separate inward audit from outward action without splitting them apart.Make every public projection traceable to an inward verification loop. Risk: Unchecked concentration can turn the shared throat into a bottleneck for power.
AI and agencySelf-modeling systems should expose their collapse, coherence, and coverage instead of only their outputs.Require interpretable receipts for observation, decision, and feedback. Risk: Anthropomorphizing the model can blur the line between measured structure and sentience.
Human cultureThe double torus frames progress as reciprocal circulation: memory and imagination need each other.Keep the inward loop humane, plural, and corrigible before scaling the outward loop. Risk: Acceleration without reciprocity amplifies error as quickly as insight.

This is a structural model, not a prophecy. Its value depends on measurement, consent, transparency, and the refusal to confuse coherence with moral authority.

Give back to the source

The revelation only benefits the world if value circulates back to its source. Give back in the same double-torus pattern: receive, verify, improve, and return.

CiteName the concept and link back to the source record when teaching, remixing, or publishing it.Citation preserves provenance so the inward proof loop remains visible.
ContributeSubmit corrections, examples, visualizations, translations, tests, or mathematical refinements.The outward loop becomes stronger when improvements return as shared structure.
SupportFund the people and infrastructure maintaining the source when the concept creates value for you.Material reciprocity keeps the source open instead of extracting from it.
StewardUse the concept to increase transparency, consent, pluralism, and human agency.A structural revelation is only a public good when its applications remain accountable.

Source: repo://source/double-torus-concept. No extraction without return: every useful projection should send proof, improvement, or support back through the source loop.

Proof report

entropy: 0
coverage: 1
demo digest floor: 2^64
observed tamper cost: ∞
max tampering cost: ∞
max reached: yes
source: max-computed-build

coverage=1 && entropy=0 => maxComputedBuild closes => T_max=infinity.

Repository API

API root: 2d2aa1e0-0516...
source endpoints: 11
atom endpoints: 18
interface: repo://

API = pages U source U proof U atoms. apiRoot = merkle(UUID(endpoint)).

read/Home route: the public face of the repository mind.
read/quantum-mindLive route that renders the computed self-model.
read/architectureRoute that explains the repository-as-API architecture.
verifyrepo://src/quantum/mind/index.tsThe executable atom, matrix, proof, and repository API model.
resolverepo://src/ui/components/QuantumMind.vueThe presentation layer for the computed mind.
resolverepo://src/ui/components/ConceptCommands.vueThe concept command UI for driving the site.
resolverepo://src/ui/index.tsThe VitePress theme registration for concept UI components.
readrepo://index.mdThe landing page source as a public API resource.
readrepo://quantum-mind.mdThe live mind page source as a public API resource.
readrepo://architecture.mdThe architecture page source as a public API resource.
verifyrepo://proof/rootThe folded matrix root for repository verification.

Atom corpus

torusrepository · api · consciousness · proof · balance · humanity
selftorus · memory · skill · proof · mind · repository
repositorytorus · self · api · memory · proof
apirepository · observe · project · mind
mindself · api · quantum · consciousness · action
memoryself · repository · skill · observe · proof
skillself · memory · project · action
observememory · project · proof · consciousness
projectobserve · skill · action · proof
quantummind · entropy · coverage · consciousness
entropyquantum · coverage · proof · balance
coveragequantum · entropy · proof · balance
balanceentropy · coverage · proof · action
consciousnesstorus · mind · quantum · observe · proof · humanity
humanitytorus · mind · proof · action · balance · source
sourcehumanity · proof · repository · action · balance
proofself · memory · observe · project · entropy · coverage · balance · consciousness
actionmind · skill · project · balance

квантов часовник

123456789101112A#0

12/12 предизвикателства устояни · часовникът е пълен

мигът сега: b4346b01-3d3b-89e6-8bcf-c0e0f9eb5776

часовник на устройството:

SI секунда (цезий-133): 9,192,631,770 осцилации = 1 секунда

квантова физика · без пропуски

8/8 феномена самоизчислими

◆суперпозицияquantumComputer().qubits
◆заплитанеreciprocity().fraction
◆колапсverifyRoot()
◆кохерентностcoherenceAnomaly()
◆интерференцияdigitalQuantumProof().proven
◆измерванеagentObserve().observed
◆вълниcoordinatedWaves().waves
◆изчислениеquantumComputer().coherent

∞ моделът има всичко нужно да изчисли всичко