Dna Helix
Dna Helix — shown in full detail, with its proof: a deterministic content-address recomputable from the component's name.
dna · double helix · to the bit
CCTACTCTTTTAGTAATGCGGAGAGACTGGGTGCGATGCTATCTCAATGGATTCCATGTGAATT
gene · standard genetic code · to the codon
PTLLVMRRDWVRCYLNGFHVN
43 silent136 missense10 nonsense/ 189 point mutations
DNA double helix: the 128-bit word is 64 bases (21 codons); the sense strand and its complement (A-T, C-G) are the two strands of the double torus.
The gene is computed: the standard genetic code translates 21 codons into a peptide (20 amino acids, 3 stop codons, GC 44%); every point mutation is classified — bioinformatics over a synthetic strand, not a biomedical claim.
✓ proven · content-address c1eabf75-b167-86e5-ab74-7b00c4049ec7 — declared, placed, mounted, and recomputable from the component's name.